circad | circRNAs associated with diseases

hsa_circ_0001859
Gene	TCONS_l2_00028722	Organism	Human
Genome Locus	chr9:37086664-37121125:+	Build	hg19
Disease	Rheumatoid Arthritis	ICD-10	Rheumatoid arthritis, unspecified (M06.9)
DBLink	Link to database	PMID	29577053
Experimental Method
Sample Type	SW982 cell line	Comparison	SW982 cells were cotransfected individually with wild-type 3"�-UTR or the mutant sequence and miR-204 mimics
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCCGAGAGAGAGTCCAGTCTT Reverse AAAGGGTCACAGCTCCCGAA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, B, Li, N, Zhang, L, Li, K, Xie, Y, Xue, M, Zheng, Z (2018). Hsa_circ_0001859 Regulates ATF2 Expression by Functioning as an MiR-204/211 Sponge in Human Rheumatoid Arthritis. J Immunol Res, 2018:9412387.